Stem-loop sequence mml-mir-10a

AccessionMI0007587 (change log)
DescriptionMacaca mulatta miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention mml-mir-10a
(3 sentences)

Stem-loop
   ----gauc   --c    uu        a    g     c          uaaggaa 
5'         ugu   uguc  cuguauau cccu uagau cgaauuugug       u
           |||   ||||  |||||||| |||| ||||| ||||||||||        
3'         aca   acag  gauguaua gggg aucua gcuuaaacac       u
   cucgccuc   aau    uu        a    -     u          ugguguu 
Get sequence
Deep sequencing
4902965 reads, 4.11e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 41307365-41307473 [+]
antisense
ENSMMUT00000024239 ; MYCBPAP-201; intron 12
Database links

Mature sequence mml-miR-10a-5p

Accession MIMAT0006161
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Deep sequencing4901423 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-10a-3p

Accession MIMAT0026797
Sequence

64 - 

aaauucguaucuaggggaaua

 - 84

Get sequence
Deep sequencing1527 reads, 8 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).