Stem-loop sequence mml-mir-10a

Accession MI0007587
Description Macaca mulatta miR-10a stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----gauc   --c    uu        a    g     c          uaaggaa 
        ugu   uguc  cuguauau cccu uagau cgaauuugug       u
        |||   ||||  |||||||| |||| ||||| ||||||||||        
        aca   acag  gauguaua gggg aucua gcuuaaacac       u
cucgccuc   aau    uu        a    -     u          ugguguu 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 32809599-32809707 [-]
sense
Database links

Mature sequence mml-miR-10a

Accession MIMAT0006161
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Evidence by similarity; MI0000266
Predicted targets

References

1