Stem-loop sequence mml-mir-9-3

AccessionMI0007586 (change log)
DescriptionMacaca mulatta miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention mml-mir-9-3
(2 sentences)

Stem-loop
   g    cc       -  c               g     gu  ca 
5'  gagg  cguuucu cu uuugguuaucuagcu uauga  gc  c
    ||||  ||||||| || ||||||||||||||| |||||  ||   
3'  cucu  guaaaga ga aagccaauagaucga auacu  cg  a
   a    ca       u  -               a     gc  ag 
Get sequence
Deep sequencing
6900097 reads, 3.74e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 67381821-67381910 [+]
intergenic
Database links

Mature sequence mml-miR-9-5p

Accession MIMAT0006160
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing20181550 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-9-3-3p

Accession MIMAT0031078
Sequence

55 - 

auaaagcuagauaaccgaaagu

 - 76

Get sequence
Deep sequencing172794 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).