Stem-loop sequence mml-mir-9-2

AccessionMI0007585 (change log)
DescriptionMacaca mulatta miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention mml-mir-9-2
(2 sentences)

Stem-loop
   g    c     g   uc               g      ug a 
5'  gaag gaguu uua  uuugguuaucuagcu uaugag  u u
    |||| ||||| |||  ||||||||||||||| ||||||  |  
3'  cuuc cucaa aau  aagccaauagaucga auacuu  g u
   a    -     a   ga               a      cu g 
Get sequence
Deep sequencing
6899990 reads, 3.74e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 85611111-85611197 [-]
intergenic
Database links

Mature sequence mml-miR-9-5p

Accession MIMAT0006160
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing20181550 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-9-3p

Accession MIMAT0026796
Sequence

53 - 

auaaagcuagauaaccgaaagua

 - 75

Get sequence
Deep sequencing345612 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).