Stem-loop sequence mml-mir-9-2

Accession MI0007585
Description Macaca mulatta miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g    c     g   uc               g      ug a 
 gaag gaguu uua  uuugguuaucuagcu uaugag  u u
 |||| ||||| |||  ||||||||||||||| ||||||  |  
 cuuc cucaa aau  aagccaauagaucga auacuu  g u
a    -     a   ga               a      cu g 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 84955411-84955497 [-]
intergenic
Database links

Mature sequence mml-miR-9

Accession MIMAT0006160
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence by similarity; MI0000466
Predicted targets

References

1