Stem-loop sequence mml-mir-9-1

AccessionMI0007584 (change log)
DescriptionMacaca mulatta miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention mml-mir-9-1
(2 sentences)

Stem-loop
   c       guug   uc               g      u  ug 
5'  gggguug    uua  uuugguuaucuagcu uaugag gg  u
    |||||||    |||  ||||||||||||||| |||||| ||  g
3'  ccccaau    aau  aagccaauagaucga auacuu cu  g
   a       -aaa   ga               a      -  ga 
Get sequence
Deep sequencing
6899877 reads, 3.74e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 131037358-131037446 [-]
antisense
ENSMMUT00000045639 ; PEAR1-201; intron 15
Database links

Mature sequence mml-miR-9-5p

Accession MIMAT0006160
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing20181550 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-9-3p

Accession MIMAT0026796
Sequence

55 - 

auaaagcuagauaaccgaaagua

 - 77

Get sequence
Deep sequencing345612 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).