Stem-loop sequence mml-mir-9-1

Accession MI0007584
Description Macaca mulatta miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c       guug   uc               g      u  ug 
 gggguug    uua  uuugguuaucuagcu uaugag gg  u
 |||||||    |||  ||||||||||||||| |||||| ||  g
 ccccaau    aau  aagccaauagaucga auacuu cu  g
a       -aaa   ga               a      -  ga 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 135024723-135024811 [-]
sense
Database links

Mature sequence mml-miR-9

Accession MIMAT0006160
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence by similarity; MI0000466
Predicted targets

References

1