Stem-loop sequence mml-mir-7-3

AccessionMI0007583 (change log)
DescriptionMacaca mulatta miR-7-3 stem-loop
Gene family MIPF0000022; mir-7
Literature search

2 open access papers mention mml-mir-7-3
(4 sentences)

Stem-loop
   agauua   u  cuau     a        u  aa a  a       u      c  au 
5'       gag gg    ggucu gugcugug gg  g cu gugauuu guuguu ug  g
         ||| ||    ||||| |||||||| ||  | || ||||||| |||||| ||   
3'       cuu cc    ucaga cgcgauac cc  c ga cacuaaa caacag au  u
   ---cag   c  ----     -        u  gg c  -       -      c  cg 
Get sequence
Deep sequencing
82452 reads, 356 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 4909005-4909114 [+]
intergenic
Database links

Mature sequence mml-miR-7

Accession MIMAT0006159
Sequence

31 - 

uggaagacuagugauuuuguugu

 - 53

Get sequence
Deep sequencing247093 reads, 9 experiments
Evidence by similarity; MI0000265
Database links
Predicted targets

References

1