Stem-loop sequence mml-mir-7-2

AccessionMI0007582 (change log)
DescriptionMacaca mulatta miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Literature search

2 open access papers mention mml-mir-7-2
(4 sentences)

Stem-loop
   cuggauacagag  a          c    c   a     a u     u       ucuua 
5'             ug aguggcuggc ccgu ugg agacu g gauuu guuguug     c
               || |||||||||| |||| ||| ||||| | ||||| |||||||      
3'             ac uuaccgaccg ggua gcc ucuga c cuaaa caacaac     u
   ------------  g          u    a   g     c -     -       ucgcg 
Get sequence
Deep sequencing
82913 reads, 356 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 66600869-66600978 [+]
antisense
ENSMMUT00000001961 ; NTRK3-202; intron 11
ENSMMUT00000001962 ; NTRK3-201; intron 12
ENSMMUT00000001963 ; NTRK3-203; intron 12
ENSMMUT00000001965 ; NTRK3-205; intron 12
Clustered miRNAs
< 10kb from mml-mir-7-2
mml-mir-1179chr7: 66597137-66597247 [+]
mml-mir-7-2chr7: 66600869-66600978 [+]
Database links

Mature sequence mml-miR-7

Accession MIMAT0006159
Sequence

32 - 

uggaagacuagugauuuuguugu

 - 54

Get sequence
Deep sequencing247093 reads, 9 experiments
Evidence by similarity; MI0000265
Database links
Predicted targets

References

1