Stem-loop sequence mml-mir-7-1

AccessionMI0007581 (change log)
DescriptionMacaca mulatta miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Literature search

2 open access papers mention mml-mir-7-1
(4 sentences)

Stem-loop
   --u    u  -      a  u        a     a       u      --     a 
5'    ugga gu uggccu gu cugugugg agacu gugauuu guuguu  uuuag u
      |||| || |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    aucu cg accgga ca gguauacc ucuga cacuaaa caacag  aaauc a
   gac    c  u      -  c        g     -       -      uu     a 
Get sequence
Deep sequencing
83763 reads, 356 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 100309013-100309122 [-]
antisense
ENSMMUT00000032527 ; NTRK2-204; intron 11
ENSMMUT00000032528 ; NTRK2-203; intron 12
ENSMMUT00000032529 ; NTRK2-202; intron 12
Database links

Mature sequence mml-miR-7

Accession MIMAT0006159
Sequence

24 - 

uggaagacuagugauuuuguugu

 - 46

Get sequence
Deep sequencing247093 reads, 9 experiments
Evidence by similarity; MI0000265
Database links
Predicted targets

References

1