Stem-loop sequence mml-let-7i

Accession MI0007580
Description Macaca mulatta let-7i stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     u                 u   --------  u     ugu 
cuggc gagguaguaguuugugc guu        gg cgggu   g
||||| ||||||||||||||||| |||        || |||||   a
gaucg uuccgucaucgaacgcg caa        uc gcccg   c
     -                 u   uagaggug  -     uua 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
11: 59792467-59792551 [+]
intergenic
Database links

Mature sequence mml-let-7i

Accession MIMAT0006158
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Evidence by similarity; MI0000434
Predicted targets

References

1