Stem-loop sequence mml-let-7i

AccessionMI0007580 (change log)
DescriptionMacaca mulatta let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention mml-let-7i
(7 sentences)

Stem-loop
        u                 u   --------  u     ugu 
5' cuggc gagguaguaguuugugc guu        gg cgggu   g
   ||||| ||||||||||||||||| |||        || |||||   a
3' gaucg uuccgucaucgaacgcg caa        uc gcccg   c
        -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
1163885 reads, 7.37e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 61524606-61524690 [+]
antisense
ENSMMUT00000016735 ; PPM1H-201; intron 1
Database links

Mature sequence mml-let-7i-5p

Accession MIMAT0006158
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Deep sequencing1163126 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-let-7i-3p

Accession MIMAT0026795
Sequence

63 - 

ugcgcaagcuacugccuugcu

 - 83

Get sequence
Deep sequencing754 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).