Stem-loop sequence mml-let-7f-2

Accession MI0007578
Description Macaca mulatta let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u      u   gu                uuagggucauac 
 guggga gag  aguagauuguauaguu            c
 |||||| |||  ||||||||||||||||             
 cacccu uuc  ucaucugacauaucaa            c
g      -   ug                uagagguucuac 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 51873135-51873217 [-]
sense
Clustered miRNAs
< 10kb from mml-let-7f-2
mml-let-7f-2 X: 51873135-51873217 [-]
mml-mir-98 X: 51872188-51872267 [-]
Database links

Mature sequence mml-let-7f

Accession MIMAT0006156
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Evidence by similarity; MI0000068
Predicted targets

References

1