Stem-loop sequence mml-let-7f-2

AccessionMI0007578 (change log)
DescriptionMacaca mulatta let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention mml-let-7f-2
(7 sentences)

Stem-loop
   u      u   gu                uuagggucauac 
5'  guggga gag  aguagauuguauaguu            c
    |||||| |||  ||||||||||||||||             
3'  cacccu uuc  ucaucugacauaucaa            c
   g      -   ug                uagagguucuac 
Get sequence
Deep sequencing
17229818 reads, 1.21e+05 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 52964085-52964167 [-]
sense
ENSMMUT00000007642 ; WNK3-201; intron 1
ENSMMUT00000007643 ; WNK3-202; intron 1
Clustered miRNAs
< 10kb from mml-let-7f-2
mml-let-7f-2chrX: 52964085-52964167 [-]
mml-mir-98chrX: 52963138-52963217 [-]
Database links

Mature sequence mml-let-7f-5p

Accession MIMAT0006156
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Deep sequencing34424192 reads, 9 experiments
Evidence by similarity; MI0000068
Database links
Predicted targets

References

1