Stem-loop sequence mml-let-7f-1

Accession MI0007577
Description Macaca mulatta let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    a ug                      ---------       u 
ucag g  agguaguagauuguauaguugu         gggguag g
|||| |  ||||||||||||||||||||||         ||||||| a
aguc c  uccguuaucuaacauaucaaua         ucccauu u
    - cu                      gaggacuug       u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
15: 105917663-105917749 [+]
intergenic
Clustered miRNAs
< 10kb from mml-let-7f-1
mml-let-7a-1 15: 105917273-105917352 [+]
mml-let-7f-1 15: 105917663-105917749 [+]
mml-let-7d 15: 105920139-105920225 [+]
Database links

Mature sequence mml-let-7f-5p

Accession MIMAT0006156
Sequence

7 - 

ugagguaguagauuguauaguu

 - 28

Get sequence
Evidence by similarity; MI0000068
Predicted targets

Mature sequence mml-let-7f-3p

Accession MIMAT0026793
Sequence

63 - 

cuauacaaucuauugccuuccc

 - 84

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).