Stem-loop sequence mml-let-7e

AccessionMI0007576 (change log)
DescriptionMacaca mulatta let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention mml-let-7e
(9 sentences)

Stem-loop
     c   cu   g                u  ----gga  a 
5' cc ggg  gag uaggagguuguauagu ga       gg c
   || |||  ||| |||||||||||||||| ||       ||  
3' gg ccc  uuc auccuccggcauauca cu       cc a
     a   cu   g                -  agaggaa  c 
Get sequence
Deep sequencing
10508921 reads, 7.48e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 46928012-46928090 [+]
intergenic
Clustered miRNAs
< 10kb from mml-let-7e
mml-mir-99bchr19: 46927837-46927906 [+]
mml-let-7echr19: 46928012-46928090 [+]
mml-mir-125achr19: 46928481-46928566 [+]
Database links

Mature sequence mml-let-7e-5p

Accession MIMAT0006155
Sequence

8 - 

ugagguaggagguuguauaguu

 - 29

Get sequence
Deep sequencing10508622 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-let-7e-3p

Accession MIMAT0026792
Sequence

53 - 

cuauacggccuccuagcuuucc

 - 74

Get sequence
Deep sequencing281 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).