Stem-loop sequence mml-let-7c

AccessionMI0007574 (change log)
DescriptionMacaca mulatta let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention mml-let-7c
(7 sentences)

Stem-loop
     a      uu   g   u             ua  g ua a 
5' gc uccggg  gag uag agguuguaugguu  ga u  c c
   || ||||||  ||| ||| |||||||||||||  || |  | c
3' cg agguuc  uuc auc uccaacaugucaa  uu a  g c
     -      cu   g   u             --  g gg u 
Get sequence
Deep sequencing
20094293 reads, 1.4e+05 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 31070403-31070486 [-]
intergenic
Clustered miRNAs
< 10kb from mml-let-7c
mml-mir-99achr3: 31071139-31071219 [-]
mml-let-7cchr3: 31070403-31070486 [-]
Database links

Mature sequence mml-let-7c-5p

Accession MIMAT0006153
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Deep sequencing20093996 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-let-7c-3p

Accession MIMAT0026791
Sequence

56 - 

cuguacaaccuucuagcuuucc

 - 77

Get sequence
Deep sequencing214 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).