Stem-loop sequence mml-let-7b

AccessionMI0007573
DescriptionMacaca mulatta let-7b stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     u                     ----  ---a      u 
cgggg gagguaguagguugugugguu    uc    gggcag g
||||| |||||||||||||||||||||    ||    |||||| a
guccc uuccgucauccaacauaucaa    ag    cccguu u
     -                     uaga  acuc      g 
Get sequence
Deep sequencing
1003113 reads, 1.68e+04 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr10: 90937903-90937985 [+]
sense
ENSMMUT00000043908 ; TBC1D22A-203; intron 6
ENSMMUT00000005326 ; TBC1D22A-201; intron 8
ENSMMUT00000005327 ; TBC1D22A-202; intron 8
Clustered miRNAs
< 10kb from mml-let-7b
mml-let-7a-3chr10: 90936986-90937059 [+]
mml-let-7bchr10: 90937903-90937985 [+]
Database links

Mature sequence mml-let-7b-5p

Accession MIMAT0006152
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Deep sequencing5229 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-let-7b-3p

Accession MIMAT0026790
Sequence

60 - 

cuauacaaccuacugccuuccc

 - 81

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).