Stem-loop sequence mml-let-7a-3

AccessionMI0007572 (change log)
DescriptionMacaca mulatta let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention mml-let-7a-3
(10 sentences)

Stem-loop
      u   gu                ---------        
5' ggg gag  aguagguuguauaguu         uggggcu 
   ||| |||  ||||||||||||||||         |||||| c
3' ucc uuc  ucaucuaacauaucaa         gucccgu 
      u   ug                uaggguauc        
Get sequence
Deep sequencing
20856129 reads, 1.45e+05 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 88293991-88294064 [+]
sense
ENSMMUT00000043908 ; TBC1D22A-203; intron 6
ENSMMUT00000005326 ; TBC1D22A-201; intron 8
ENSMMUT00000005327 ; TBC1D22A-202; intron 8
Clustered miRNAs
< 10kb from mml-let-7a-3
mml-let-7a-3chr10: 88293991-88294064 [+]
mml-let-7bchr10: 88294908-88294990 [+]
Database links

Mature sequence mml-let-7a-5p

Accession MIMAT0006151
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Deep sequencing62712661 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-let-7a-3p

Accession MIMAT0026789
Sequence

52 - 

cuauacaaucuacugucuuucc

 - 73

Get sequence
Deep sequencing926 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).