Stem-loop sequence mml-let-7a-2

AccessionMI0007571 (change log)
DescriptionMacaca mulatta let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention mml-let-7a-2
(10 sentences)

Stem-loop
      cu   g   u             uagaa ua a 
5' agg  gag uag agguuguauaguu     u  c u
   |||  ||| ||| |||||||||||||     |  | c
3' ucc  uuc auc uccgacaugucaa     a  g a
      -u   g   c             --uag gg a 
Get sequence
Deep sequencing
20884115 reads, 1.45e+05 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 115000985-115001056 [-]
antisense
ENSMMUT00000008946 ; CCDC15-201; intron 3
Clustered miRNAs
< 10kb from mml-let-7a-2
mml-mir-100chr14: 115006675-115006754 [-]
mml-let-7a-2chr14: 115000985-115001056 [-]
Database links

Mature sequence mml-let-7a-5p

Accession MIMAT0006151
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Deep sequencing62712661 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-let-7a-2-3p

Accession MIMAT0031041
Sequence

50 - 

cuguacagccuccuagcuuucc

 - 71

Get sequence
Deep sequencing59 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).