Stem-loop sequence mml-let-7a-2

AccessionMI0007571
DescriptionMacaca mulatta let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cu   g   u             uagaa ua a 
agg  gag uag agguuguauaguu     u  c u
|||  ||| ||| |||||||||||||     |  | c
ucc  uuc auc uccgacaugucaa     a  g a
   -u   g   c             --uag gg a 
Get sequence
Deep sequencing
590520 reads, 1.13e+04 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr14: 123110827-123110898 [-]
antisense
ENSMMUT00000008946 ; CCDC15-201; intron 3
Clustered miRNAs
< 10kb from mml-let-7a-2
mml-mir-100chr14: 123116508-123116587 [-]
mml-let-7a-2chr14: 123110827-123110898 [-]
Database links

Mature sequence mml-let-7a-5p

Accession MIMAT0006151
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Deep sequencing3367 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-let-7a-2-3p

Accession MIMAT0031041
Sequence

50 - 

cuguacagccuccuagcuuucc

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).