Stem-loop sequence mml-let-7a-1

AccessionMI0007570 (change log)
DescriptionMacaca mulatta let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention mml-let-7a-1
(10 sentences)

Stem-loop
        u   gu                uuagggucacac 
5' uggga gag  aguagguuguauaguu            c
   ||||| |||  ||||||||||||||||            c
3' auccu uuc  ucaucuaacauaucaa            a
        -   ug                uagagggucacc 
Get sequence
Deep sequencing
20974614 reads, 1.45e+05 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 44322723-44322802 [+]
intergenic
Clustered miRNAs
< 10kb from mml-let-7a-1
mml-let-7a-1chr15: 44322723-44322802 [+]
mml-let-7f-1chr15: 44323112-44323198 [+]
mml-let-7dchr15: 44325586-44325672 [+]
Database links

Mature sequence mml-let-7a-5p

Accession MIMAT0006151
Sequence

6 - 

ugagguaguagguuguauaguu

 - 27

Get sequence
Deep sequencing62712661 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1