Stem-loop sequence mml-mir-1-2

AccessionMI0007569 (change log)
DescriptionMacaca mulatta miR-1-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

3 open access papers mention mml-mir-1-2
(47 sentences)

Stem-loop
   -c                     ac     ugaaca 
5'   agaguacauacuucuuuaugu  ccaua      u
     |||||||||||||||||||||  |||||       
3'   uuuuauguaugaagaaaugua  gguau      a
   gu                     -a     cguaac 
Get sequence
Deep sequencing
11024427 reads, 5.49e+04 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr18: 10284217-10284288 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-1-2
mml-mir-1-2chr18: 10284217-10284288 [-]
mml-mir-133achr18: 10280933-10281020 [-]
Database links

Mature sequence mml-miR-1-2-5p

Accession MIMAT0031099
Sequence

7 - 

acauacuucuuuauguacccaua

 - 29

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-1-3p

Accession MIMAT0006150
Sequence

46 - 

uggaauguaaagaaguauguau

 - 67

Get sequence
Deep sequencing22045433 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).