Stem-loop sequence mml-mir-1-1

AccessionMI0007568 (change log)
DescriptionMacaca mulatta miR-1-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

3 open access papers mention mml-mir-1-1
(47 sentences)

Stem-loop
           a                gc     ---   a 
5' gcuuggga acauacuucuuuauau  ccaua   ugg c
   |||||||| ||||||||||||||||  |||||   ||| c
3' cggacucu uguaugaagaaaugua  gguau   auc u
           a                -a     cga   g 
Get sequence
Deep sequencing
11021030 reads, 5.49e+04 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 1807717-1807793 [-]
intergenic
Database links

Mature sequence mml-miR-1-1-5p

Accession MIMAT0026788
Sequence

10 - 

acauacuucuuuauaugcccaua

 - 32

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-1-3p

Accession MIMAT0006150
Sequence

49 - 

uggaauguaaagaaguauguau

 - 70

Get sequence
Deep sequencing22045433 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).