Stem-loop sequence gga-mir-458a

AccessionMI0007567 (change log)
Previous IDsgga-mir-458
DescriptionGallus gallus miR-458 stem-loop
Gene family MIPF0000179; mir-458
Literature search

2 open access papers mention gga-mir-458a
(2 sentences)

Stem-loop
   a   g  cc  -----gg  gu      g       cg      uc        aa    c 
5'  gca ag  gc       cc  ggugca auggcag  ccauuu  agagcuau  acag g
    ||| ||  ||       ||  |||||| |||||||  ||||||  ||||||||  |||| u
3'  cgu uc  cg       gg  ucaugu uaccguc  gguaag  ucucgaua  uguu c
   -   a  ua  acaaaaa  --      a       au      uu        -c    a 
Get sequence
Deep sequencing
146952 reads, 1.5e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 8233311-8233426 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-458a
gga-mir-458bchr13: 8233317-8233418 [+]
gga-mir-458achr13: 8233311-8233426 [-]
Database links

Mature sequence gga-miR-458a-5p

Accession MIMAT0007745
Previous IDsgga-miR-458*
Sequence

30 - 

agcgccauuuucagagcuaua

 - 50

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-458a-3p

Accession MIMAT0007746
Previous IDsgga-miR-458
Sequence

66 - 

auagcucuuugaaugguacugc

 - 87

Get sequence
Deep sequencing146897 reads, 5 experiments
Evidence by similarity; MI0002179
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).