Stem-loop sequence gga-mir-449b

AccessionMI0007566 (change log)
DescriptionGallus gallus miR-449b stem-loop
Gene family MIPF0000133; mir-449
Literature search

4 open access papers mention gga-mir-449b
(7 sentences)

Stem-loop
   -------------    ug  u  aa         cugu   c       g gc 
5'              ccug  gc gg  ggcagugug    uag ggcugcu u  u
                ||||  || ||  |||||||||    ||| ||||||| |  g
3'              ggac  cg cc  ccgucacac    auc cugacga g  a
   cgucaucagauag    gu  u  -a         ---c   a       g ua 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 16703096-16703189 [-]
sense
ENSGALT00000043537 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from gga-mir-449b
gga-mir-449cchrZ: 16704099-16704170 [-]
gga-mir-449bchrZ: 16703096-16703189 [-]
gga-mir-449achrZ: 16702946-16703031 [-]
gga-mir-449dchrZ: 16702080-16702162 [-]
Database links

Mature sequence gga-miR-449b-5p

Accession MIMAT0007743
Previous IDsgga-miR-449b
Sequence

13 - 

aggcagugugcuguuagcggcug

 - 35

Get sequence
Deep sequencing17 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-449b-3p

Accession MIMAT0007744
Previous IDsgga-miR-449b*
Sequence

51 - 

cagucacuaccacacugccac

 - 71

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).