Stem-loop sequence gga-mir-301b

AccessionMI0007565 (change log)
DescriptionGallus gallus miR-301b stem-loop
Gene family MIPF0000034; mir-130
Literature search

5 open access papers mention gga-mir-301b
(7 sentences)

Stem-loop
   guug     aa  a     c    ---u          a  -  acu 
5'     cugcu  cg augcu ugac    uuauugcacu cu gu   u
       |||||  || ||||| ||||    |||||||||| || ||    
3'     gacga  gu uacga acug    gauaacguga ga cg   c
   --ga     aa  c     a    uuau          c  u  aca 
Get sequence
Deep sequencing
8868 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 7202692-7202781 [-]
sense
ENSGALT00000034804 ; SKA2-201; intron 1
Clustered miRNAs
< 10kb from gga-mir-301b
gga-mir-130cchr19: 7202980-7203073 [-]
gga-mir-301bchr19: 7202692-7202781 [-]
Database links

Mature sequence gga-miR-301b-5p

Accession MIMAT0007741
Sequence

17 - 

gcucugacuuuauugcacuacu

 - 38

Get sequence
Deep sequencing109 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-301b-3p

Accession MIMAT0007742
Sequence

54 - 

cagugcaauaguauugucaaagcau

 - 78

Get sequence
Deep sequencing8759 reads, 5 experiments
Evidence experimental; Illumina [1], Northern [2]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).