Stem-loop sequence gga-mir-301b

Accession MI0007565
Description Gallus gallus miR-301b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
guug     aa  a     c    ---u          a  -  acu 
    cugcu  cg augcu ugac    uuauugcacu cu gu   u
    |||||  || ||||| ||||    |||||||||| || ||    
    gacga  gu uacga acug    gauaacguga ga cg   c
--ga     aa  c     a    uuau          c  u  aca
Get sequence
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr19: 7193224-7193313 [-]
antisense
Clustered miRNAs
< 10kb from gga-mir-301b
gga-mir-130c chr19: 7193512-7193605 [-]
gga-mir-301b chr19: 7193224-7193313 [-]
Database links

Mature sequence gga-miR-301b-5p

Accession MIMAT0007741
Sequence

17 -  

gcucugacuuuauugcacuacu

 - 38

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence gga-miR-301b-3p

Accession MIMAT0007742
Sequence

54 -  

cagugcaauaguauugucaaagcau

 - 78

Get sequence
Evidence experimental; Solexa [1], Northern [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).