Stem-loop sequence gga-mir-193a

AccessionMI0007564 (change log)
DescriptionGallus gallus miR-193a stem-loop
Gene family MIPF0000082; mir-193
Literature search

5 open access papers mention gga-mir-193a
(19 sentences)

Stem-loop
                 u     cg   g  a   -  g u 
5' agcugagggcuggg cuuug  ggc ag uga ga g u
   |||||||||||||| |||||  ||| || ||| || |  
3' ucggcucuugaccc gaaac  ccg uc acu cu u c
                 u     au   g  a   u  g g 
Get sequence
Deep sequencing
3431 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence does not map exactly to the galGal4.0 chicken genome assembly, but is annotated based on a Trace Achive sequence (J_AD0537A21_t807e807.b2).

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr18: 6491327-6491403 [+]
intergenic
Database links

Mature sequence gga-miR-193a-5p

Accession MIMAT0026787
Sequence

11 - 

ugggucuuugcgggcgagauga

 - 32

Get sequence
Deep sequencing3053 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-193a-3p

Accession MIMAT0007740
Sequence

48 - 

aacuggccuacaaagucccagu

 - 69

Get sequence
Deep sequencing378 reads, 5 experiments
Evidence experimental; Illumina [1,3], cloned [2], Northern [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).