Stem-loop sequence gga-mir-16c

AccessionMI0007563 (change log)
DescriptionGallus gallus miR-16c stem-loop
Gene family MIPF0000006; mir-15
Literature search

23 open access papers mention gga-mir-16c
(225 sentences)

Stem-loop
      cu       cgua          ---u g   a 
5' gcu  agcagca    aauacuggag    g ggg u
   |||  |||||||    ||||||||||    | |||  
3' uga  ucgucgu    uuaugaccuc    u ucc c
      uu       uacg          ucgu g   g 
Get sequence
Deep sequencing
218035 reads, 2.78e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 4071445-4071515 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-16c
gga-mir-15cchr4: 4071811-4071886 [-]
gga-mir-16cchr4: 4071445-4071515 [-]
Database links

Mature sequence gga-miR-16c-5p

Accession MIMAT0007739
Sequence

5 - 

uagcagcacguaaauacuggag

 - 26

Get sequence
Deep sequencing218029 reads, 5 experiments
Evidence experimental; Illumina [1,3], Northern [2]
Predicted targets

Mature sequence gga-miR-16c-3p

Accession MIMAT0026786
Sequence

48 - 

ccaguauugcauugcugcuuua

 - 69

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).