Stem-loop sequence gga-mir-15c

AccessionMI0007562 (change log)
DescriptionGallus gallus miR-15c stem-loop
Gene family MIPF0000006; mir-15
Literature search

14 open access papers mention gga-mir-15c
(41 sentences)

Stem-loop
   u    a    ua     a  uc          gggac 
5'  gagg gaug  gcagc ca  augguuugua     a
    |||| ||||  ||||| ||  ||||||||||      
3'  cucc uuac  cgucg gu  uaccagacau     a
   a    a    uc     g  cu          agagg 
Get sequence
Deep sequencing
11571 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 4071811-4071886 [-]
sense
ENSGALT00000041417 ; gga-mir-15c-201; exon 1
Clustered miRNAs
< 10kb from gga-mir-15c
gga-mir-15cchr4: 4071811-4071886 [-]
gga-mir-16cchr4: 4071445-4071515 [-]
Database links

Mature sequence gga-miR-15c-5p

Accession MIMAT0007737
Previous IDsgga-miR-15c
Sequence

11 - 

uagcagcacaucaugguuugua

 - 32

Get sequence
Deep sequencing11566 reads, 5 experiments
Evidence experimental; Illumina [1], Northern [2]
Predicted targets

Mature sequence gga-miR-15c-3p

Accession MIMAT0007738
Previous IDsgga-miR-15c*
Sequence

47 - 

cagaccauucugggcugccuca

 - 68

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).