Stem-loop sequence gga-mir-146c

AccessionMI0007561 (change log)
Previous IDsgga-mir-146c;gga-mir-146c-1
DescriptionGallus gallus miR-146c stem-loop
Gene family MIPF0000103; mir-146
Literature search

14 open access papers mention gga-mir-146c
(28 sentences)

Stem-loop
   ---ga  a     cgaaucuug    uu  c    cu           u           uuu  au 
5'      ag uguga         gcag  cc agcu  gagaacugaau ccauggacugg   ca  u
        || |||||         ||||  || ||||  ||||||||||| |||||||||||   ||   
3'      uc acacu         cguc  gg ucga  cucuugacuua gguaccugacu   gu  c
   aaucg  a     -ucaaacua    --  u    -u           u           ugc  ac 
Get sequence
Deep sequencing
3532431 reads, 5.29e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 89315822-89315950 [-]
sense
ENSGALT00000025785 ; DDRGK1-201; intron 7
Database links

Mature sequence gga-miR-146c

Accession MIMAT0007735
Sequence

34 - 

ugagaacugaauuccauggacug

 - 56

Get sequence
Deep sequencing7062106 reads, 5 experiments
Evidence experimental;

Mature sequence gga-miR-146c-3p

Accession MIMAT0007736
Previous IDsgga-miR-146c*
Sequence

76 - 

aguccaugguauucaguucucu

 - 97

Get sequence
Deep sequencing1378 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).