Stem-loop sequence gga-mir-130c

Accession

MI0007560

Description

Gallus gallus miR-130c stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

uuga   g  u   u    c        u          a  -a   au 
    gcg ug cug ccag gcccuuuu auguuguacu cu  gug  c
    ||| || ||| |||| |||||||| |||||||||| ||  |||   
    cgu ac gac gguu cgggaaaa uguaacguga ga  cac  a
----   g  -   c    a        u          c  aa   au 

Genome context

• Coordinates (Gallus-gallus-4.0): chr19: 7193512-7193605 [-]
• Overlapping transcripts:

  antisense

  ENSGALT00000008193 ; intron 2

Clustered miRNAs

< 10kb from gga-mir-130c

• gga-mir-130c: chr19: 7193512-7193605 [-]
• gga-mir-301b: chr19: 7193224-7193313 [-]

Database links

• ENTREZGENE: 100315856;MIR130C

Mature sequence gga-miR-130c-5p

• Accession: MIMAT0007733
• Previous IDs: gga-miR-130c*
• Sequence: 21 - gcccuuuuuauguuguacuacu - 42
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • MIRDB:gga-miR-130c-5p

Mature sequence gga-miR-130c-3p

• Accession: MIMAT0007734
• Previous IDs: gga-miR-130c
• Sequence: 60 - cagugcaauguuaaaagggcau - 81
• Evidence: experimental; Solexa [1], cloned [2], Northern [2]
• Predicted targets:
  • MIRDB:gga-miR-130c-3p

References

1. PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2. PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).