|
miRBase |
|
miRBase has moved to http://www.mirbase.org/ - please update your links.
Stem-loop sequence MI0007559 |
|||||
| Accession | MI0007559 | ||||
| ID | gga-mir-10a | ||||
| Description | Gallus gallus miR-10a stem-loop | ||||
| Stem-loop |
a g c uaaagg cuauaugu cccu uagau cgaauuugug a |||||||| |||| ||||| |||||||||| a gauguaua gggg aucua gcuuaaacac g a - u uggguu |
||||
| Genome context |
|
||||
| Gene family |
MIPF0000033; mir-10 |
||||
Mature sequence MIMAT0007731 |
|
| Accession | MIMAT0007731 |
| ID | gga-miR-10a |
| Sequence |
8 - uacccuguagauccgaauuugu - 29 |
| Evidence | experimental; Solexa [1], cloned [2] |
| Predicted targets |
|
Minor miR* sequence MIMAT0007732 |
|
| Accession | MIMAT0007732 |
| ID | gga-miR-10a* |
| Sequence |
49 - aaauucguaucuaggggaaua - 69 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|
| 2 |
"Identification of novel chicken microRNAs and analysis of their genomic organization"
Gene. 418:34-40(2008).
|