Stem-loop sequence gga-mir-10a

AccessionMI0007559 (change log)
DescriptionGallus gallus miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

19 open access papers mention gga-mir-10a
(44 sentences)

Stem-loop
           a    g     c          uaaagg 
5' cuauaugu cccu uagau cgaauuugug      a
   |||||||| |||| ||||| ||||||||||      a
3' gauguaua gggg aucua gcuuaaacac      g
           a    -     u          uggguu 
Get sequence
Deep sequencing
2463497 reads, 3.28e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr27: 3834170-3834243 [+]
intergenic
Database links

Mature sequence gga-miR-10a-5p

Accession MIMAT0007731
Previous IDsgga-miR-10a
Sequence

8 - 

uacccuguagauccgaauuugu

 - 29

Get sequence
Deep sequencing2459657 reads, 5 experiments
Evidence experimental; Illumina [1], cloned [2]
Database links
Predicted targets

Mature sequence gga-miR-10a-3p

Accession MIMAT0007732
Previous IDsgga-miR-10a*
Sequence

49 - 

aaauucguaucuaggggaaua

 - 69

Get sequence
Deep sequencing3840 reads, 4 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).