Stem-loop sequence gga-mir-101-2

AccessionMI0007558 (change log)
DescriptionGallus gallus miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Literature search

15 open access papers mention gga-mir-101-2
(216 sentences)

Stem-loop
      gc   ggc                  a    --gu u 
5' gcu  ccu   ucaguuaucacagugcug ugcu    c c
   |||  |||   |||||||||||||||||| ||||    |  
3' cgg  gga   agucaauagugucaugac augg    g u
      ua   ---                  -    aaau u 
Get sequence
Deep sequencing
2049097 reads, 2.71e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 28360430-28360505 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-101-2
gga-mir-12282chr8: 28362266-28362331 [-]
gga-mir-12281chr8: 28361180-28361252 [-]
gga-mir-101-2chr8: 28360430-28360505 [-]
Database links

Mature sequence gga-miR-101-2-5p

Accession MIMAT0031077
Sequence

12 - 

ucaguuaucacagugcugaugcu

 - 34

Get sequence
Deep sequencing2136 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-101-3p

Accession MIMAT0001185
Sequence

48 - 

guacaguacugugauaacugaa

 - 69

Get sequence
Deep sequencing4095283 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
5
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
6
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).