Stem-loop sequence gga-mir-1812

AccessionMI0007557 (change log)
DescriptionGallus gallus miR-1812 stem-loop
Stem-loop
   -cuu                            c       agg 
5'     uauugggaaccuagauauauacuguaua uguguca   u
       |||||||||||||||||||||||||||| |||||||   u
3'     auaaucuuuggaucuauauaugacauau auacagu   u
   gaac                            c       aga 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 1274982-1275069 [-]
intergenic
Database links

Mature sequence gga-miR-1812-5p

Accession MIMAT0007730
Sequence

18 - 

auauauacuguauacuguguca

 - 39

Get sequence
Deep sequencing37 reads, 3 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence gga-miR-1812-3p

Accession MIMAT0026785
Sequence

52 - 

cauacuauacaguauauaucua

 - 73

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).