Stem-loop sequence gga-mir-1805

AccessionMI0007550 (change log)
DescriptionGallus gallus miR-1805 stem-loop
Gene family MIPF0000947; mir-1805
Literature search

1 open access papers mention gga-mir-1805
(1 sentences)

Stem-loop
       ua   u            c      -    a cuu  ca 
5' ggaa  uuc gggaguuguagu uuucaa acag g   ug  a
   ||||  ||| |||||||||||| |||||| |||| |   ||   
3' ccuu  aag cccucgacauca aagguu uguc c   ac  g
       -c   u            c      a    - -au  ag 
Get sequence
Deep sequencing
9590 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 131070174-131070257 [-]
sense
ENSGALT00000030259 ; GABRG3-201; intron 5
Database links

Mature sequence gga-miR-1805-5p

Accession MIMAT0007722
Sequence

13 - 

gaguuguagucuuucaaacaga

 - 34

Get sequence
Deep sequencing851 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1805-3p

Accession MIMAT0007723
Sequence

53 - 

uguauuggaacacuacagcuc

 - 73

Get sequence
Deep sequencing8735 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).