Stem-loop sequence gga-mir-122b

AccessionMI0007547 (change log)
DescriptionGallus gallus miR-122b stem-loop
Literature search

16 open access papers mention gga-mir-122b
(83 sentences)

Stem-loop
          agacag          --g       g ugg 
5' auuuuuc      ugugacacug   uguuuuu u   g
   |||||||      ||||||||||   ||||||| |   u
3' uggaaag      auauugugac   gcgaggg g   g
          auacag          gga       g uuu 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 59089899-59089975 [-]
sense
ENSGALT00000019955 ; UNC5C-201; intron 1
ENSGALT00000037649 ; UNC5C-202; intron 1
Database links

Mature sequence gga-miR-122b

Accession MIMAT0007719
Sequence

12 - 

agugugacacugguguuuuu

 - 31

Get sequence
Deep sequencing39 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).