Stem-loop sequence gga-mir-1786

AccessionMI0007529 (change log)
DescriptionGallus gallus miR-1786 stem-loop
Literature search

3 open access papers mention gga-mir-1786
(21 sentences)

Stem-loop
      g   cc   -c     c      cu       a       caaau   gcau 
5' ucu cuc  uga  ugcuu uaauuc  uaacaca caggaaa     uca    u
   ||| |||  |||  ||||| ||||||  ||||||| |||||||     |||    a
3' aga gag  acu  augaa auuaag  auugugu gucuuuu     agu    a
      -   aa   uc     a      uc       c       --cuu   auaa 
Get sequence
Deep sequencing
127 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 7768588-7768696 [+]
sense
Database links

Mature sequence gga-miR-1786

Accession MIMAT0007698
Sequence

64 - 

auucuuuucugcuguguuacu

 - 84

Get sequence
Deep sequencing123 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).