Stem-loop sequence gga-mir-1784

AccessionMI0007527 (change log)
DescriptionGallus gallus miR-1784 stem-loop
Gene family MIPF0001873; mir-1784
Stem-loop
   u   -ccaa         g                  g  a      --  a 
5'  gga     uuucuuggg cccaauucugcucuuauu aa ucagug  ag g
    |||     ||||||||| |||||||||||||||||| || ||||||  ||  
3'  ccu     gaagaaucc ggguuaagacgaggauaa uu aguuac  uc u
   a   uuaga         a                  a  c      cg  u 
Get sequence
Deep sequencing
347 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 35737908-35738010 [+]
sense
ENSGALT00000017474 ; PLD5-201; intron 8
Clustered miRNAs
< 10kb from gga-mir-1784
gga-mir-1784chr3: 35737908-35738010 [+]
gga-mir-1784bchr3: 35737929-35737986 [-]
Database links

Mature sequence gga-miR-1784-5p

Accession MIMAT0007696
Previous IDsgga-miR-1784*
Sequence

24 - 

uucugcucuuauugaaaucagu

 - 45

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).