Stem-loop sequence gga-mir-1775

AccessionMI0007518 (change log)
DescriptionGallus gallus miR-1775 stem-loop
Stem-loop
       au   c  u    g    gu  a        acaaaca    a 
5' gugu  gag uc gaau cuuc  gc acaggaag       ggcu a
   ||||  ||| || |||| ||||  || ||||||||       |||| g
3' caca  cuc ag cuua gaag  cg uguccuuc       cuga c
       gu   u  u    -    ac  a        -------    g 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 2412385-2412473 [+]
sense
ENSGALT00000005993 ; NELL1-201; intron 14
Database links

Mature sequence gga-miR-1775-5p

Accession MIMAT0026784
Sequence

13 - 

ugaaugcuucgugcaacaggaag

 - 35

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-1775-3p

Accession MIMAT0007686
Sequence

58 - 

uccuguagccagaagauucuga

 - 79

Get sequence
Deep sequencing57 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).