|
miRBase |
|
Stem-loop sequence gga-mir-1767 |
|||||
| Accession | MI0007510 | ||||
| Description | Gallus gallus miR-1767 stem-loop | ||||
| Stem-loop |
- ggccg u g ggcu ggcugcug cuucuu ccuc g |||| |||||||| |||||| |||| g ucga ucgacgac gaggag ggag u g ---aa c a |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence gga-miR-1767 |
|
| Accession | MIMAT0007675 |
| Sequence |
35 - aggcgaggagaacagcagcu - 54 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18469162
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|