Stem-loop sequence gga-mir-1759

AccessionMI0007501 (change log)
DescriptionGallus gallus miR-1759 stem-loop
Gene family MIPF0001565; mir-1759
Stem-loop
             --  -u    --      -    -   acc 
5' gcugcuguag  gg  agga  ggagag aggu guu   u
   ||||||||||  ||  ||||  |||||| |||| |||    
3' cgacgacguc  cc  uccu  ccucuc uccg cga   u
             uu  uc    ac      c    u   cua 
Get sequence
Deep sequencing
1212 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 62727636-62727710 [-]
sense
ENSGALT00000042881 ; PHACTR1-201; intron 2
Database links

Mature sequence gga-miR-1759-5p

Accession MIMAT0007666
Sequence

8 - 

uaggguaggaggagagaggugu

 - 29

Get sequence
Deep sequencing1208 reads, 4 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence gga-miR-1759-3p

Accession MIMAT0026783
Sequence

43 - 

gccuccucucccauccucuccuucu

 - 67

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).