Stem-loop sequence gga-mir-1754

AccessionMI0007496 (change log)
DescriptionGallus gallus miR-1754 stem-loop
Stem-loop
     g         -        cugg      c  ug 
5' cu cucgugcug gagcuguu    cugggu ac  u
   || ||||||||| ||||||||    |||||| ||   
3' gg gggcacgac cucgacgg    gaccca ug  g
     g         a        ----      -  uc 
Get sequence
Deep sequencing
416 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 23541427-23541494 [-]
intergenic
AADN04011577.1: 6068-6135 [+]
intergenic
Database links

Mature sequence gga-miR-1754-5p

Accession MIMAT0007661
Sequence

5 - 

ucgugcuggagcuguucugg

 - 24

Get sequence
Deep sequencing401 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence gga-miR-1754-3p

Accession MIMAT0026782
Sequence

46 - 

agggcagcucacagcacgggg

 - 66

Get sequence
Deep sequencing13 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).