Stem-loop sequence gga-mir-1747

AccessionMI0007487 (change log)
DescriptionGallus gallus miR-1747 stem-loop
Stem-loop
       g  gc   g        u  ag   u    g uc 
5' ccag gu  ugu cacuugaa gg  uuc gggu u  u
   |||| ||  ||| |||||||| ||  ||| |||| |   
3' gguu ca  aca gugaacuu cc  aag ccua g  c
       g  aa   g        -  cu   u    g ua 
Get sequence
Deep sequencing
133 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 61829376-61829452 [-]
intergenic
Database links

Mature sequence gga-miR-1747-5p

Accession MIMAT0007652
Sequence

12 - 

ugcacuugaauggaguucuggg

 - 33

Get sequence
Deep sequencing128 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence gga-miR-1747-3p

Accession MIMAT0026781
Sequence

47 - 

ccugaaucccuucaaguggaca

 - 68

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).