Stem-loop sequence gga-mir-1744

AccessionMI0007483 (change log)
DescriptionGallus gallus miR-1744 stem-loop
Gene family MIPF0001589; mir-1744
Literature search

2 open access papers mention gga-mir-1744
(4 sentences)

Stem-loop
   --         a c    gc     -       c    a   uga 
5'   ggagucagg c cagu  ugcuc uguugaa ucaa agc   a
     ||||||||| | ||||  ||||| ||||||| |||| |||    
3'   uuuuagucc g guca  acgag acaacuu aguu uug   c
   cc         c a    ga     g       c    g   ucc 
Get sequence
Deep sequencing
95 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-1744-5p

Accession MIMAT0007648
Previous IDsgga-miR-1744*
Sequence

19 - 

ugcucuguugaacucaaaagcu

 - 40

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1744-3p

Accession MIMAT0007649
Previous IDsgga-miR-1744
Sequence

55 - 

acuucaacaggagcaagacuga

 - 76

Get sequence
Deep sequencing89 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).