Stem-loop sequence gga-mir-1731

AccessionMI0007470 (change log)
DescriptionGallus gallus miR-1731 stem-loop
Stem-loop
        -ccucu      ag c   u  uu     c   c      gc      
5' cuugg      gcugga  c ggg ac  gacug agg acugcu  ucugu 
   |||||      ||||||  | ||| ||  ||||| ||| ||||||  |||| u
3' gaauc      ugaccu  g ucc ug  cuggu ucc ugacgg  agacc 
        cuuccu      cu u   -  uu     -   u      uu      
Get sequence
Deep sequencing
113 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 10660971-10661072 [-]
intergenic
Database links

Mature sequence gga-miR-1731-5p

Accession MIMAT0007633
Sequence

25 - 

acuugacugcaggcacugcugcu

 - 47

Get sequence
Deep sequencing105 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence gga-miR-1731-3p

Accession MIMAT0026780
Sequence

59 - 

uggcaguuccuuggucuugucc

 - 80

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).