Stem-loop sequence gga-mir-1729

AccessionMI0007468 (change log)
DescriptionGallus gallus miR-1729 stem-loop
Gene family MIPF0000816; mir-1729
Literature search

3 open access papers mention gga-mir-1729
(4 sentences)

Stem-loop
        -    c        a         g   cua 
5' ccugc aucc uuacucac ugaguaguc uau   u
   ||||| |||| |||||||| ||||||||| |||    
3' ggacg uagg aaugagug gcucaucag gug   u
        a    -        -         g   acu 
Get sequence
Deep sequencing
3698 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 762734-762804 [+]
intergenic
Database links

Mature sequence gga-miR-1729-5p

Accession MIMAT0007629
Previous IDsgga-miR-1729
Sequence

6 - 

aucccuuacucacaugaguaguc

 - 28

Get sequence
Deep sequencing2714 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence gga-miR-1729-3p

Accession MIMAT0007630
Previous IDsgga-miR-1729*
Sequence

47 - 

cuacucggugaguaaggauagc

 - 68

Get sequence
Deep sequencing983 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).