Stem-loop sequence gga-mir-1728

AccessionMI0007466 (change log)
DescriptionGallus gallus miR-1728 stem-loop
Literature search

1 open access papers mention gga-mir-1728
(2 sentences)

Stem-loop
            u   u          cau      a   --a    gagg 
5' gugaauuag uca cugguugauc   uggaag cug   gcuu    g
   ||||||||| ||| ||||||||||   |||||| |||   ||||    u
3' uacuuaguc agu gaccgacuag   gucuuc gac   ugga    g
            c   c          -au      g   aaa    gaaa 
Get sequence
Deep sequencing
1139 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 10981360-10981455 [-]
sense
ENSGALT00000043548 ; PRRG3-201; intron 1
Database links

Mature sequence gga-miR-1728-5p

Accession MIMAT0007627
Sequence

16 - 

ugguugauccauuggaagacuga

 - 38

Get sequence
Deep sequencing48 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1728-3p

Accession MIMAT0007628
Sequence

62 - 

aggcuucuguagaucagccagc

 - 83

Get sequence
Deep sequencing1090 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).