Stem-loop sequence gga-mir-1720

AccessionMI0007457 (change log)
DescriptionGallus gallus miR-1720 stem-loop
Stem-loop
   u  u    -     gga          g ga a 
5'  uc gauc accuc   cguugcuuug u  c a
    || |||| |||||   |||||||||| |  | c
3'  ag cugg uggag   gcaacgaaac g  g c
   a  u    c     --a          - ag c 
Get sequence
Deep sequencing
3861 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 13134585-13134649 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1720
gga-mir-3529chr10: 13134724-13134814 [+]
gga-mir-7-2chr10: 13134720-13134818 [-]
gga-mir-1720chr10: 13134585-13134649 [-]
Database links

Mature sequence gga-miR-1720-5p

Accession MIMAT0007617
Previous IDsgga-miR-1720*
Sequence

4 - 

ugaucaccucggacguugcuuu

 - 25

Get sequence
Deep sequencing809 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1720-3p

Accession MIMAT0007618
Previous IDsgga-miR-1720
Sequence

43 - 

aagcaacgagaggucggucuga

 - 64

Get sequence
Deep sequencing3052 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).