Stem-loop sequence gga-mir-1719

AccessionMI0007456 (change log)
DescriptionGallus gallus miR-1719 stem-loop
Literature search

1 open access papers mention gga-mir-1719
(1 sentences)

Stem-loop
   u    aa     uguuu     aaa  au    -a      --    u 
5'  ugag  guacu     guacc   ag  gaug  guugcu  gaug g
    ||||  |||||     |||||   ||  ||||  ||||||  |||| c
3'  auuc  uauga     cgugg   uc  uugu  caaugg  cugu u
   a    gc     -----     --g  cu    cg      ag    u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 884864-884952 [-]
sense
Database links

Mature sequence gga-miR-1719

Accession MIMAT0007616
Sequence

24 - 

aaagaugaugaguugcugaug

 - 44

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).