Stem-loop sequence gga-mir-1711

AccessionMI0007448 (change log)
DescriptionGallus gallus miR-1711 stem-loop
Literature search

2 open access papers mention gga-mir-1711
(3 sentences)

Stem-loop
      u ug    ------   g  -     u   aga 
5' cac g  cagu      gcu ca ucucu caa   c
   ||| |  ||||      ||| || ||||| |||   a
3' gug u  gucg      ugg gu agagg guu   u
      u gu    auuguu   g  c     u   auu 
Get sequence
Deep sequencing
92 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 16440167-16440234 [-]
sense
ENSGALT00000046181 ; RYBP-201; intron 1
Database links

Mature sequence gga-miR-1711

Accession MIMAT0007606
Sequence

5 - 

gugcagugcugcaucucuuc

 - 24

Get sequence
Deep sequencing92 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).