Stem-loop sequence gga-mir-449c

AccessionMI0007445 (change log)
DescriptionGallus gallus miR-449c stem-loop
Literature search

5 open access papers mention gga-mir-449c
(8 sentences)

Stem-loop
    ug      c     g   u   u        --u    
5' g  gucugg agugc ugu agc ggcuguug   ccc 
   |  |||||| ||||| ||| ||| ||||||||   || a
3' c  cagacc ucacg gca ucg ucgacaac   gga 
    gu      -     -   c   -        cau    
Get sequence
Deep sequencing
20 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 16704099-16704170 [-]
sense
ENSGALT00000043537 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from gga-mir-449c
gga-mir-449cchrZ: 16704099-16704170 [-]
gga-mir-449bchrZ: 16703096-16703189 [-]
gga-mir-449achrZ: 16702946-16703031 [-]
gga-mir-449dchrZ: 16702080-16702162 [-]
Database links

Mature sequence gga-miR-449c-5p

Accession MIMAT0007602
Previous IDsgga-miR-449c
Sequence

7 - 

uggcagugcguguuagcuggcugu

 - 30

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-449c-3p

Accession MIMAT0007603
Previous IDsgga-miR-449c*
Sequence

47 - 

cagcugcucacggcacuccaga

 - 68

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).