Stem-loop sequence gga-mir-1703

AccessionMI0007438 (change log)
DescriptionGallus gallus miR-1703 stem-loop
Stem-loop
       u     a    u a ag    u     c  u     aauua 
5' agcu gccgc ggau c g  gcug agguc cg gcuuu     a
   |||| ||||| |||| | |  |||| ||||| || |||||      
3' ucga cggug ccua g c  cgac uucag gc cgaag     a
       -     -    c a cu    -     u  u     caaga 
Get sequence
Deep sequencing
849 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 58127887-58127975 [-]
sense
ENSGALT00000020198 ; TRIM9-201; intron 1
Database links

Mature sequence gga-miR-1703-5p

Accession MIMAT0007595
Sequence

18 - 

agaggcuguaggucccgugcuuu

 - 40

Get sequence
Deep sequencing841 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence gga-miR-1703-3p

Accession MIMAT0026779
Sequence

57 - 

cucgugacuucagcuccagca

 - 77

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).