Stem-loop sequence gga-mir-1684a

AccessionMI0007418 (change log)
Previous IDsgga-mir-1684
DescriptionGallus gallus miR-1684 stem-loop
Gene family MIPF0001537; mir-1684
Literature search

4 open access papers mention gga-mir-1684a
(7 sentences)

Stem-loop
       u     ---u  a            gc          a  cu   cu 
5' ugga cgggu    ug aaggagagcucu  uuccucauac ua  cau  u
   |||| |||||    || ||||||||||||  |||||||||| ||  |||  u
3' auuu gucca    ac uuccucucgagg  aaggaguaug au  gua  u
       u     ccuu  c            ua          a  ag   uc 
Get sequence
Deep sequencing
3335 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-1684a-5p

Accession MIMAT0007571
Previous IDsgga-miR-1684*
Sequence

21 - 

agcucugcuuccucauacauac

 - 42

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1684a-3p

Accession MIMAT0007572
Previous IDsgga-miR-1684
Sequence

60 - 

aaguaugaggaaauggagcucu

 - 81

Get sequence
Deep sequencing3333 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).