Stem-loop sequence gga-mir-1683

AccessionMI0007417 (change log)
DescriptionGallus gallus miR-1683 stem-loop
Literature search

1 open access papers mention gga-mir-1683
(1 sentences)

Stem-loop
       u  ca   -ucc  ug c        --uu     a  u    g   g 
5' gcug gc  ggc    ac  g aagaugcu    uuguc cc ggau uga a
   |||| ||  |||    ||  | ||||||||    ||||| || |||| ||| u
3' cgac ug  ucg    ug  c uucuacga    gacag gg cuug acu g
       -  ug   uauu  gu u        cacu     -  u    -   g 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 49924840-49924940 [-]
intergenic
Database links

Mature sequence gga-miR-1683

Accession MIMAT0007570
Sequence

59 - 

ucugggacagucacagcaucuuu

 - 81

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).