Stem-loop sequence gga-mir-1682

AccessionMI0007416 (change log)
DescriptionGallus gallus miR-1682 stem-loop
Literature search

1 open access papers mention gga-mir-1682
(1 sentences)

Stem-loop
      aaaacaaa     ga    ------        ------   a 
5' ggg        gcccu  cagu      uggcccac      ccu c
   |||        |||||  ||||      ||||||||      |||  
3' ccc        uggga  gucg      acugggug      gga c
      -------g     --    agguag        cccguc   g 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 4947156-4947228 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1682
gga-mir-33-2chr14: 4937943-4938029 [-]
gga-mir-1682chr14: 4947156-4947228 [+]
Database links

Mature sequence gga-miR-1682

Accession MIMAT0007569
Sequence

48 - 

ugggucagauggagcugaggg

 - 68

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).